|
ATCC
sfb 16s rdna gene primers 5 gacgctgaggcatgagagcat Sfb 16s Rdna Gene Primers 5 Gacgctgaggcatgagagcat, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sfb/16S/pm42185250-288-47-77 Average 99 stars, based on 1 article reviews
sfb 16s rdna gene primers 5 gacgctgaggcatgagagcat - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
Macklin Inc
sorafenib sfb Sorafenib Sfb, supplied by Macklin Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sfb/sfb+sorafenib/pmc13050115-41-9-20 Average 86 stars, based on 1 article reviews
sorafenib sfb - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Jackson Laboratory
conventional c57bl 6j sfb mice Conventional C57bl 6j Sfb Mice, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sfb/6j+c57bl+free+germ+mice/pmc13201753-322-0-8 Average 86 stars, based on 1 article reviews
conventional c57bl 6j sfb mice - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Bovogen Biologicals Pty
sfbs f s00jf Sfbs F S00jf, supplied by Bovogen Biologicals Pty, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sfb/f+s00jf+sfbs/pmc13144739-61-7-5 Average 86 stars, based on 1 article reviews
sfbs f s00jf - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Biotechnology Information
human sfb ![]() Human Sfb, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sfb/1+human+ml+sfb/pmc13153320-632-10-25 Average 86 stars, based on 1 article reviews
human sfb - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
ajinomoto althea
basic04-ct ![]() Basic04 Ct, supplied by ajinomoto althea, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sfb/StemFit+Basic04/pmc12864042-25-0-4 Average 96 stars, based on 1 article reviews
basic04-ct - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
|
Thermo Fisher
s protein flag streptavidin binding peptide sfb tagged proteins ![]() S Protein Flag Streptavidin Binding Peptide Sfb Tagged Proteins, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sfb/Streptavidin/pmc12802833-221-5-32 Average 99 stars, based on 1 article reviews
s protein flag streptavidin binding peptide sfb tagged proteins - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
ATCC
neoantigen construct sfb 3340 ![]() Neoantigen Construct Sfb 3340, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sfb/B16-F10/pm41535459-423-10-22 Average 99 stars, based on 1 article reviews
neoantigen construct sfb 3340 - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
Journal: Nature Communications
Article Title: Segmented filamentous bacteria are worldwide human gut commensals
doi: 10.1038/s41467-026-70010-4
Figure Lengend Snippet: Analysis of fecal samples from bioproject PRJNA234437. a Maximum likelihood phylogenetic tree of 16S rRNA gene sequences from SFB from various hosts; includes Clostridium outgroup species (italic). Tree includes bootstrap values, and the scale is nucleotide substitutions per nucleotide position. Sequences are trimmed to the 16S rRNA gene 1470 bp position but includes shorter sequences, including only the V1-V4 region for mackerel, pinfish, macaque, and shorebird (Supplementary Fig. ). b Percent nucleotide identities across SFB 16S rRNA gene sequences of 1366 bp in length from various hosts (Supplementary Fig. ). c Gram stain of Mouse-SFB-NL from the intestinal content of monocolonized mice. Highlights SFB filament sections that are c (i/ii) thin and smooth with c (i) long primary and c (ii) short secondary segments, as well as c (iii) thick and bulbous sections characteristic of differentiation, and c (iv) a filament section containing spores. d Gram stain of The Gambia (GM) sample 102358 from a non-diarrheal control group child showing a complete filament and zooms (z) to the (z1) smooth filament end; (z2) smooth to bulbous transition; (z3) heavily de-stained bulbous segments towards filament end with crystal violet staining reminiscent of intracellular offsprings; and (z4) white unstained spores at filament end. (z1-z4) Arrows highlight the various features. e Schematic representation of inferred SFB filament stages. f Gram stain of a disintegrating filament in The Gambia sample 102358 with large oval spores at filament end, including a zoom to highlight spores. g Gram stain of the Kenya (KE) sample 401080 from a non-dysentery diarrheal group child showing a filament with a zoom (z1) to the thin, apparently tip-like, end and (z2) to the bulbous filament end. h Gram stains of the Mali (ML) sample 200340 (S340, Human-SFB-ML-1) from a non-diarrheal control group child, including h (i) a filament with a zoom to the characteristically (z1) thin and (z2) bulbous phenotype of SFB, and h (ii) a filament with spores at one end, highlighted with a black arrow. i Gram stain of the Mali sample 200195 (S195, Human-SFB-ML-2) from a non-dysentery diarrheal group child showing filamentous bacteria and a zoom (z) of one filament. a , b , d – i Labeling includes the two-letter country codes of the sample of origin, except YIT, which also originated from Japan. Images in ( d ) and ( g ) include increased bilinear interpolation for clarity.
Article Snippet: The raw sequencing files and the metagenome-assembled genomes (MAGs) for
Techniques: Staining, Control, Bacteria, Labeling
Journal: Nature Communications
Article Title: Segmented filamentous bacteria are worldwide human gut commensals
doi: 10.1038/s41467-026-70010-4
Figure Lengend Snippet: a , b Fluorescent in situ hybridization of the ML-1 fecal sample showing staining with a , b (i) the SFB-specific (green) and eubacterial (EUB338) (red) 16S rDNA probes or a , b (ii) only the SFB-specific eubacterial probe in black and white. a Image with two SFB filaments, including a zoom (z) in brightfield highlighting the smooth (white arrow) and bulbous (black arrow) morphology of the filament. b Image with an SFB filament of uneven thickness, a potential SFB filament fragment, and two small SFB highlighted (z1/z2) in both color and, for the SFB probe only, in black and white. The small SFB has an apparent teardrop-shaped morphology (white arrows). Images in (z1/z2) include increased bilinear interpolation for clarity. c SEM images c (i/ii) of the Human-SFB-ML-1 (non-diarrheal) fecal sample showing the smooth end and of a filament with zooms to the characteristically SFB tip structure, and for l (ii) also a zoom of filament thickening. d SEM images (i/ii) of the Human-SFB-ML-2 (diarrheal) fecal sample showing disintegrating filaments with zooms of the tip structure. e SEM images of the Human-SFB-ML-1 fecal sample showing e (i/ii) filaments with a contrasting smooth and bulbous morphology along the filament with zooms of opposite filament ends included for ( e (i)); e (iii) a filament with a characteristic segmented phenotype of SFB, and e (iv) a filament, including a zoom, with an irregular and large bulbous segmented phenotype similar to the spore-containing filament segment in the Gram stains of Fig. and Fig. .
Article Snippet: The raw sequencing files and the metagenome-assembled genomes (MAGs) for
Techniques: In Situ Hybridization, Staining
Journal: Nature Communications
Article Title: Segmented filamentous bacteria are worldwide human gut commensals
doi: 10.1038/s41467-026-70010-4
Figure Lengend Snippet: a Schematic of the components of the glycogen and starch utilization module identified in the Human-SFB-ML genomes. Includes the gene locus tags for Human-SFB-ML-1 (S340) and 2 (S195) for reference. b Sugar-binding affinities of Human-SFB-ML MdxE showing the results for each substrate from two independent experiments for a single purified protein sample. Carbohydrates with a α-(1,4) linkage of glucose subunits are colored in black when linear and gray when circular; Trehalose and isomaltose are dimers of glucose with a α-(1,1) and α-(1,6) linkage, respectively. c Schematic of the biosynthetic pathways for polyamines. Predicted enzymes present in all eight genomes are in green, a Orn/Lys/Arg decarboxylase predicted to be present in all genomes but whose substrate specificity is unclear is in black, and the enzyme predicted to be present only in the Human-SFB-ML genomes is in red. Polyamines are shaded in gray.
Article Snippet: The raw sequencing files and the metagenome-assembled genomes (MAGs) for
Techniques: Starch, Binding Assay, Purification
Journal: Science Advances
Article Title: YAP/TAZ-VGLL3 governs adipocyte fate via epigenetic reprogramming of PPARγ and its target enhancers
doi: 10.1126/sciadv.aea7235
Figure Lengend Snippet: ( A ) The 3D structure of human TAZ (UniProt accession Q9GZV5 ) predicted by AlphaFold is shown on the left. The domain organization of human TAZ is shown on the right: TEAD binding domain (TBD), WW domain, coiled-coil (CC) domain, transactivation domain (TAD), and PDZ binding motif. Serine-to-alanine (SA) mutation sites for constitutively active mutants (red circles) and a TEAD-binding–deficient mutant (blue circle). ( B and C ) Streptavidin pull-down assay for human embryonic kidney (HEK) 293T cells showing the interaction of green fluorescent protein (GFP)–tagged PPARγ2 (B) or endogenous TEADs and LATS1 (C) with SFB (S protein–FLAG–streptavidin binding peptide)–tagged TAZ mutants. ( D to F ) C3H10T1/2 cells stably expressing doxycycline-inducible 2xHA-tagged TAZ mutants were subjected to immunoblot analysis (D), RT-qPCR analysis ( n = 3) (E), and lipid staining with oil red O (F). Scale bars, 200 μm (F). ( G ) MA plot showing differential H3K27ac ChIP-seq signals between control and TAZ2SA-expressing C3H10T1/2 cells (left) and heatmaps showing H3K27ac ChIP-seq signals for cells expressing the indicated TAZ2SA mutants (right). Significantly changed regions (|fold change| > 2 and adj. P value of <0.05) in TAZ2SA-expressing versus control cells are colored red (fold change > 2) or blue (fold change < −2). ( H ) Genome browser views of the indicated loci showing the coverage of the H3K27ac ChIP-seq signal in differentiated C3H10T1/2 cells expressing the TAZ mutants. ( I ) Heatmap of the H3K27ac ChIP-seq signals from C3H10T1/2 cells expressing indicated TAZ mutants, aligned with PPARγ ChIP-seq peaks (D6). Data in bar graph (E) are means ± SEM and analyzed by one-way ANOVA with Tukey’s post hoc test. ** P < 0.01 and *** P < 0.001.
Article Snippet: For streptavidin-mediated pull-down assay of
Techniques: Binding Assay, Mutagenesis, Pull Down Assay, Stable Transfection, Expressing, Western Blot, Quantitative RT-PCR, Staining, ChIP-sequencing, Control
Journal: Science Advances
Article Title: YAP/TAZ-VGLL3 governs adipocyte fate via epigenetic reprogramming of PPARγ and its target enhancers
doi: 10.1126/sciadv.aea7235
Figure Lengend Snippet: ( A ) Scatter plot showing correlations between RNA fold change and ATAC gene activity change in adipocyte-related cells (LAKO versus control; sn sequencing). Color indicates the maximum percentage of cells expressing each gene. ( B ) Vgll3 expression in iWAT snRNA-seq. Dediff., Dedifferentiated adipocytes. ( C ) Genomic browser view of Vgll3 locus with the indicated sequencing data. ( D ) Mouse adipose tissue RNA-seq data ( GSE138911 ) showing Vgll3 expression [fragments per million mapped reads (FPM)] in high-fat diet (HFD) or normal chow (NC)–fed adipocyte-specific YAP/TAZ KO (YTKO) mice ( Yap1 fl/fl ; Wwtr1 fl/fl ; Adipoq-Cre ). ( E ) Human visceral adipose tissue RNA data from the GTEx consortium showing the correlation between WWTR1 and VGLL3 expression (right). ( F ) C3H10T1/2 cells expressing doxycycline (Dox)–inducible HA-TAZ2SA were treated with 2 μM VT-104 for 36 hours and subjected to RT-qPCR. ( G ) C3H10T1/2 cells (D6) expressing Dox-inducible Myc-Vgll3 were analyzed by RT-qPCR ( n = 3) and immunoblot. ( H ) Oil red O staining of Dox-inducible Vgll3 or Vgll3ΔTDU-expressing cells. Scale bars, 200 μm. ( I ) Vgll3 KO C3H10T1/2 cells expressing Dox-inducible HA-TAZ2SA and its parental cells (Con) were analyzed by RT-qPCR and immunoblot. ( J ) Genomic view of Pparg (left) and Fabp4 (right) regions with the indicated ChIP-seq data from TAZ mutant–expressing cells. ( K ) H3K27ac peak heatmap aligned with PPARγ ChIP-seq peaks (D6). ( L ) Streptavidin pull-down assay of HEK293T cells cotransfected with HA-tagged histone deacetylase 3 (HDAC3) and SFB-tagged VGLL3. ( M ) C3H10T1/2 cells with inducible Vgll3 expression (TRE-Vgll3) and Hdac3 [short hairpin Hdac3 (shHdac3)] or Ncor1 (shNcor1) knockdown or parental control (−) were treated with adipogenic cocktails and Dox or vehicle control (48 hours) and subjected to RT-qPCR. ( N ) A proposed model for the role of TAZ in adipocyte differentiation and dedifferentiation. Data in bar graphs (D, E, and G) are means ± SEM and analyzed by the unpaired t test. ** P < 0.01 and *** P < 0.001.
Article Snippet: For streptavidin-mediated pull-down assay of
Techniques: Activity Assay, Control, Sequencing, Expressing, RNA Sequencing, Quantitative RT-PCR, Western Blot, Staining, ChIP-sequencing, Mutagenesis, Pull Down Assay, Histone Deacetylase Assay, Knockdown